inducible cas9 expression construct pcw cas9 (Addgene inc)
Addgene inc is a verified supplier 
96
Structured Review
Addgene inc
inducible cas9 expression construct pcw cas9
Inducible Cas9 Expression Construct Pcw Cas9, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 346 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/cas9+expression+construct/pCW-Cas9+(Plasmid+%2350661)/pmc10089214__pnas__2218330120__sapp-27-8-13
Average 96 stars, based on 346 article reviews
Inducible Cas9 Expression Construct Pcw Cas9, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 346 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/cas9+expression+construct/pCW-Cas9+(Plasmid+%2350661)/pmc10089214__pnas__2218330120__sapp-27-8-13
Average 96 stars, based on 346 article reviews
inducible cas9 expression construct pcw cas9 - by Bioz Stars,
2026-09
96/100 stars
Images
Related Articles
Expressing:Article Title: Long poly(A) plasmids and methods for introduction of long poly(A) sequences into the plasmid Article Snippet: .. Article Title: Uncoupling of Akt and mTOR signaling drives resistance to Akt inhibition in PTEN loss prostate cancers. Article Snippet: .. Competitive cellular growth validation assay The Article Title: Uncoupling of Akt and mTOR signaling drives resistance to Akt inhibition in PTEN loss prostate cancers Article Snippet: .. The Article Title: BRAT1 links Integrator and defective RNA processing with neurodegeneration Article Snippet: The selected CRISPR guide oligonucleotide pairs were annealed and extended into a 98-mer double-stranded fragment using Phusion polymerase (Sigma) and subcloned into the guide RNA cloning vector (Addgene; 41824) using Gibson Assembly (NEB). .. For gene editing, human U2OS cells were co-transfected by the appropriate guide oligonucleotide duplex and a Article Title: A Well-Controlled BioID Design for Endogenous Bait Proteins. Article Snippet: A puromycin selection cassette was incorporated into the BE3 (Addgene, plasmid no. 73021) vector for endogenous mutagenesis purposes (BE3puro) using a linear dsDNA fragment (IDT DNA Technologies, gBlock). gRNA sequences incorporated into a U6-driven expression cassette were ordered as gBlocks (Table S2) prior to blunt-ended ligation in a pCR-Blunt vector (Thermo Fisher Scientific, K2750). .. HCT116 TP53+/T2A‐BirA* cells were generated using a combination of CRISPR/Cas9 and recombinant Adenoassociated virus (rAAV)-mediated template delivery as described before.40,41 Briefly, a TP53 C-terminal targeted gRNA (5′ ACGCACACCUAUUGCAAGCA 3′) was cloned in a Article Title: ZAR1 and ZAR2 are required for oocyte meiotic maturation by regulating the maternal transcriptome and mRNA translational activation Article Snippet: .. The Article Title: CRISPR/Cas9-mediated Disruption of Fibroblast Growth Factor 5 in Rabbits Results in a Systemic Long Hair Phenotype by Prolonging Anagen Article Snippet: .. Briefly, the Article Title: BRAT1 links Integrator and defective RNA processing with neurodegeneration. Article Snippet: The selected CRISPR guide oligonucleotide pairs were annealed and extended into a 98-mer double-stranded fragment using Phusion polymerase (Sigma) and subcloned into the guide RNA cloning vector (Addgene; 41824) using Gibson Assembly (NEB). .. For gene editing, human U2OS cells were co-transfected by the appropriate guide oligonucleotide duplex and a Construct:Article Title: Long poly(A) plasmids and methods for introduction of long poly(A) sequences into the plasmid Article Snippet: .. Article Title: Uncoupling of Akt and mTOR signaling drives resistance to Akt inhibition in PTEN loss prostate cancers. Article Snippet: .. Competitive cellular growth validation assay The Article Title: Uncoupling of Akt and mTOR signaling drives resistance to Akt inhibition in PTEN loss prostate cancers Article Snippet: .. The Article Title: BRAT1 links Integrator and defective RNA processing with neurodegeneration Article Snippet: The selected CRISPR guide oligonucleotide pairs were annealed and extended into a 98-mer double-stranded fragment using Phusion polymerase (Sigma) and subcloned into the guide RNA cloning vector (Addgene; 41824) using Gibson Assembly (NEB). .. For gene editing, human U2OS cells were co-transfected by the appropriate guide oligonucleotide duplex and a Article Title: A Well-Controlled BioID Design for Endogenous Bait Proteins. Article Snippet: A puromycin selection cassette was incorporated into the BE3 (Addgene, plasmid no. 73021) vector for endogenous mutagenesis purposes (BE3puro) using a linear dsDNA fragment (IDT DNA Technologies, gBlock). gRNA sequences incorporated into a U6-driven expression cassette were ordered as gBlocks (Table S2) prior to blunt-ended ligation in a pCR-Blunt vector (Thermo Fisher Scientific, K2750). .. HCT116 TP53+/T2A‐BirA* cells were generated using a combination of CRISPR/Cas9 and recombinant Adenoassociated virus (rAAV)-mediated template delivery as described before.40,41 Briefly, a TP53 C-terminal targeted gRNA (5′ ACGCACACCUAUUGCAAGCA 3′) was cloned in a Article Title: ZAR1 and ZAR2 are required for oocyte meiotic maturation by regulating the maternal transcriptome and mRNA translational activation Article Snippet: .. The Article Title: CRISPR/Cas9-mediated Disruption of Fibroblast Growth Factor 5 in Rabbits Results in a Systemic Long Hair Phenotype by Prolonging Anagen Article Snippet: .. Briefly, the Article Title: BRAT1 links Integrator and defective RNA processing with neurodegeneration. Article Snippet: The selected CRISPR guide oligonucleotide pairs were annealed and extended into a 98-mer double-stranded fragment using Phusion polymerase (Sigma) and subcloned into the guide RNA cloning vector (Addgene; 41824) using Gibson Assembly (NEB). .. For gene editing, human U2OS cells were co-transfected by the appropriate guide oligonucleotide duplex and a Plasmid Preparation:Article Title: Long poly(A) plasmids and methods for introduction of long poly(A) sequences into the plasmid Article Snippet: .. Article Title: ZAR1 and ZAR2 are required for oocyte meiotic maturation by regulating the maternal transcriptome and mRNA translational activation Article Snippet: .. The Article Title: CRISPR/Cas9-mediated Disruption of Fibroblast Growth Factor 5 in Rabbits Results in a Systemic Long Hair Phenotype by Prolonging Anagen Article Snippet: .. Briefly, the Biomarker Discovery:Article Title: Uncoupling of Akt and mTOR signaling drives resistance to Akt inhibition in PTEN loss prostate cancers. Article Snippet: .. Competitive cellular growth validation assay The Transfection:Article Title: Uncoupling of Akt and mTOR signaling drives resistance to Akt inhibition in PTEN loss prostate cancers. Article Snippet: .. Competitive cellular growth validation assay The Article Title: Uncoupling of Akt and mTOR signaling drives resistance to Akt inhibition in PTEN loss prostate cancers Article Snippet: .. The Generated:Article Title: A Well-Controlled BioID Design for Endogenous Bait Proteins. Article Snippet: A puromycin selection cassette was incorporated into the BE3 (Addgene, plasmid no. 73021) vector for endogenous mutagenesis purposes (BE3puro) using a linear dsDNA fragment (IDT DNA Technologies, gBlock). gRNA sequences incorporated into a U6-driven expression cassette were ordered as gBlocks (Table S2) prior to blunt-ended ligation in a pCR-Blunt vector (Thermo Fisher Scientific, K2750). .. HCT116 TP53+/T2A‐BirA* cells were generated using a combination of CRISPR/Cas9 and recombinant Adenoassociated virus (rAAV)-mediated template delivery as described before.40,41 Briefly, a TP53 C-terminal targeted gRNA (5′ ACGCACACCUAUUGCAAGCA 3′) was cloned in a CRISPR:Article Title: A Well-Controlled BioID Design for Endogenous Bait Proteins. Article Snippet: A puromycin selection cassette was incorporated into the BE3 (Addgene, plasmid no. 73021) vector for endogenous mutagenesis purposes (BE3puro) using a linear dsDNA fragment (IDT DNA Technologies, gBlock). gRNA sequences incorporated into a U6-driven expression cassette were ordered as gBlocks (Table S2) prior to blunt-ended ligation in a pCR-Blunt vector (Thermo Fisher Scientific, K2750). .. HCT116 TP53+/T2A‐BirA* cells were generated using a combination of CRISPR/Cas9 and recombinant Adenoassociated virus (rAAV)-mediated template delivery as described before.40,41 Briefly, a TP53 C-terminal targeted gRNA (5′ ACGCACACCUAUUGCAAGCA 3′) was cloned in a Recombinant:Article Title: A Well-Controlled BioID Design for Endogenous Bait Proteins. Article Snippet: A puromycin selection cassette was incorporated into the BE3 (Addgene, plasmid no. 73021) vector for endogenous mutagenesis purposes (BE3puro) using a linear dsDNA fragment (IDT DNA Technologies, gBlock). gRNA sequences incorporated into a U6-driven expression cassette were ordered as gBlocks (Table S2) prior to blunt-ended ligation in a pCR-Blunt vector (Thermo Fisher Scientific, K2750). .. HCT116 TP53+/T2A‐BirA* cells were generated using a combination of CRISPR/Cas9 and recombinant Adenoassociated virus (rAAV)-mediated template delivery as described before.40,41 Briefly, a TP53 C-terminal targeted gRNA (5′ ACGCACACCUAUUGCAAGCA 3′) was cloned in a Virus:Article Title: A Well-Controlled BioID Design for Endogenous Bait Proteins. Article Snippet: A puromycin selection cassette was incorporated into the BE3 (Addgene, plasmid no. 73021) vector for endogenous mutagenesis purposes (BE3puro) using a linear dsDNA fragment (IDT DNA Technologies, gBlock). gRNA sequences incorporated into a U6-driven expression cassette were ordered as gBlocks (Table S2) prior to blunt-ended ligation in a pCR-Blunt vector (Thermo Fisher Scientific, K2750). .. HCT116 TP53+/T2A‐BirA* cells were generated using a combination of CRISPR/Cas9 and recombinant Adenoassociated virus (rAAV)-mediated template delivery as described before.40,41 Briefly, a TP53 C-terminal targeted gRNA (5′ ACGCACACCUAUUGCAAGCA 3′) was cloned in a Clone Assay:Article Title: A Well-Controlled BioID Design for Endogenous Bait Proteins. Article Snippet: A puromycin selection cassette was incorporated into the BE3 (Addgene, plasmid no. 73021) vector for endogenous mutagenesis purposes (BE3puro) using a linear dsDNA fragment (IDT DNA Technologies, gBlock). gRNA sequences incorporated into a U6-driven expression cassette were ordered as gBlocks (Table S2) prior to blunt-ended ligation in a pCR-Blunt vector (Thermo Fisher Scientific, K2750). .. HCT116 TP53+/T2A‐BirA* cells were generated using a combination of CRISPR/Cas9 and recombinant Adenoassociated virus (rAAV)-mediated template delivery as described before.40,41 Briefly, a TP53 C-terminal targeted gRNA (5′ ACGCACACCUAUUGCAAGCA 3′) was cloned in a Article Title: CRISPR/Cas9-mediated Disruption of Fibroblast Growth Factor 5 in Rabbits Results in a Systemic Long Hair Phenotype by Prolonging Anagen Article Snippet: .. Briefly, the Synthesized:Article Title: ZAR1 and ZAR2 are required for oocyte meiotic maturation by regulating the maternal transcriptome and mRNA translational activation Article Snippet: .. The Article Title: CRISPR/Cas9-mediated Disruption of Fibroblast Growth Factor 5 in Rabbits Results in a Systemic Long Hair Phenotype by Prolonging Anagen Article Snippet: .. Briefly, the In Vitro:Article Title: CRISPR/Cas9-mediated Disruption of Fibroblast Growth Factor 5 in Rabbits Results in a Systemic Long Hair Phenotype by Prolonging Anagen Article Snippet: .. Briefly, the |
![( A ) Plot of the candidate genes from <t>CRISPR-Cas9</t> knockout (KO) screen in LNCaP cells treated with 450 nM ipatasertib on day 18. ( B ) Top genes identified from the CRISPR-Cas9 KO screen on day 18 (ipatasertib-treated LNCaP cells compared to DMSO-treated cells). ( C ) TSC2-KO LNCaP cells were subjected to a 4-hour treatment with either DMSO or 500 nM ipatasertib. Expression levels of downstream targets in the PI3K pathway were evaluated using Western Blot analysis. ( D and E ) Outcomes of a competition assay involving four candidate genes in LNCaP cells. Cells were transduced with lentivirus carrying sgNT-GFP or sgRNA-GFP targeting the candidate genes, each with two specific sgRNAs. Following transduction, cells were treated with either DMSO or 500 nM ipatasertib. The ratio of GFP + cells was normalized to the DMSO treatment group. The data represent the results of three independent experiments ( n = 3). ( F ) LNCaP, CWR22Pc-EP-sgPTEN, and PCa12, each stably expressing sgNT or sgNPRL3, were subjected to treatment with either ipatasertib (500 nM) or DMSO. Cell viability on day 7 was assessed. ( G ) WT, TSC2-KO, or NPRL3-KO LNCaP cells were exposed to 6 hours of starvation and a 4-hour treatment with either DMSO or 500 nM ipatasertib. Following this, cells were stimulated with or without amino acids for 10 min. The expression levels of downstream targets in the PI3K pathway were evaluated using Western Blot analysis {* P < 0.05, ** P < 0.01, and **** P < 0.0001; [(D) to (F)] Welch’s t test; error bar represents ±SEM}.](https://pub-med-central-images-cdn.bioz.com/pub_med_central_ids_ending_with_4928/pmc11804928/pmc11804928__sciadv.adq3802-f3.jpg)
![Fig. 2 Oncogene exposure transforms induced hepatocytes but not control fibroblasts. A Phase contrast microscope images showing the phenotype and morphology of the cells in the course of conversion of fibroblasts to iHeps at different times points after transduction with a cocktail of three TFs HNF1A, HNF4A and FOXA3 [36]. B Generation of highly proliferative iHep cells by transducing iHeps with two pools of liver cancer-specific oncogenic drivers, a list of xenograft experiments in nude mice that were used to test the tumorigenicity of different conditions, and mutation rates of the oncogenic drivers as reported in the COSMIC database for HCC and MYC amplification as reported in [43]. CMT pool contains three oncogenes CTNNB1T41A, MYC, and TERT, and CMT + sgTP53 pool contains the same oncogenes along with constructs for TP53 inactivation by <t>CRISPR-Cas9.</t> Phase contrast microscope images showing the phenotype and morphology of the cells. Oncogenes are co-transduced with fluorescent reporter mCherry for the detection of transduced cells. Oncogene transduction to fibroblasts fails to transform the cells, passaging of oncogene-expressing fibroblasts results in cellular senescence as demonstrated by β-galactosidase staining and loss of mCherry-positive oncogene-expressing cells from the fibroblast population. iHeps maintained in defined culture medium become senescent around week four of transdifferentiation although they can survive in culture for several weeks after that if not passaged. Passaging of iHeps without oncogenes results in apoptosis after few passages. Scale bar 1000 μm unless otherwise specified.](https://pub-med-unpaywalled-images-cdn.bioz.com/pub_med_ids_ending_with_2118/pm34302118/pm34302118__page3_image1.jpg)
