Review



inducible cas9 expression construct pcw cas9  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 96

    Structured Review

    Addgene inc inducible cas9 expression construct pcw cas9
    Inducible Cas9 Expression Construct Pcw Cas9, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 346 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cas9+expression+construct/pCW-Cas9+(Plasmid+%2350661)/pmc10089214__pnas__2218330120__sapp-27-8-13
    Average 96 stars, based on 346 article reviews
    inducible cas9 expression construct pcw cas9 - by Bioz Stars, 2026-09
    96/100 stars

    Images

    Related Articles

    Expressing:

    Article Title: Long poly(A) plasmids and methods for introduction of long poly(A) sequences into the plasmid
    Article Snippet: .. Cas9 expression construct was obtained from Addgene (plasmid #41815). ..

    Article Title: Uncoupling of Akt and mTOR signaling drives resistance to Akt inhibition in PTEN loss prostate cancers.
    Article Snippet: .. Competitive cellular growth validation assay The Cas9 expression construct (Addgene, 52962) was transfected into 293 T cells using Lipofectamine 2000 (Invitrogen, 11668- 500) to produce lentiviruses. ..

    Article Title: Uncoupling of Akt and mTOR signaling drives resistance to Akt inhibition in PTEN loss prostate cancers
    Article Snippet: .. The Cas9 expression construct (Addgene, 52962) was transfected into 293 T cells using Lipofectamine 2000 (Invitrogen, 11668-500) to produce lentiviruses. ..

    Article Title: BRAT1 links Integrator and defective RNA processing with neurodegeneration
    Article Snippet: The selected CRISPR guide oligonucleotide pairs were annealed and extended into a 98-mer double-stranded fragment using Phusion polymerase (Sigma) and subcloned into the guide RNA cloning vector (Addgene; 41824) using Gibson Assembly (NEB). .. For gene editing, human U2OS cells were co-transfected by the appropriate guide oligonucleotide duplex and a Cas9 expression construct (Addgene; 41815) using Lipofectamine LTX (Life Technologies). .. Twenty-four hours later, the transfected cells were selected in a medium containing 0.5 mg/ml G418 (Roche) for 5 days.

    Article Title: A Well-Controlled BioID Design for Endogenous Bait Proteins.
    Article Snippet: A puromycin selection cassette was incorporated into the BE3 (Addgene, plasmid no. 73021) vector for endogenous mutagenesis purposes (BE3puro) using a linear dsDNA fragment (IDT DNA Technologies, gBlock). gRNA sequences incorporated into a U6-driven expression cassette were ordered as gBlocks (Table S2) prior to blunt-ended ligation in a pCR-Blunt vector (Thermo Fisher Scientific, K2750). .. HCT116 TP53+/T2A‐BirA* cells were generated using a combination of CRISPR/Cas9 and recombinant Adenoassociated virus (rAAV)-mediated template delivery as described before.40,41 Briefly, a TP53 C-terminal targeted gRNA (5′ ACGCACACCUAUUGCAAGCA 3′) was cloned in a Cas9 expression construct (Addgene no. 48139) as DOI: 10.1021/acs.jproteome.8b00367 J. Proteome Res. .. XXXX, XXX, XXX−XXX B described by Ran et al.42 Cells were seeded in a 24-well plate 24 h before transfection with the Cas9 plasmid using FugeneHD (Promega, E2311).

    Article Title: ZAR1 and ZAR2 are required for oocyte meiotic maturation by regulating the maternal transcriptome and mRNA translational activation
    Article Snippet: .. The codon-optimized Cas9 expression construct, Cas9-N-NLS-flag-linker (Addgene No. 44758), was synthesized and inserted into a pST1374 vector as described previously ( ). ..

    Article Title: CRISPR/Cas9-mediated Disruption of Fibroblast Growth Factor 5 in Rabbits Results in a Systemic Long Hair Phenotype by Prolonging Anagen
    Article Snippet: .. Briefly, the Cas9 expression construct (Addgene ID: 48137), which was synthesized and cloned into the vector that was linearized by NotI, was transcribed in vitro while using a mMessage mMachine SP6 TranscriptionKit (Ambion, Austin, the United States) and a RNeasy Mini Kit (Qiagen, Valencia, USA) to purify the mRNA. .. Complementary oligonucleotides, 20-nt guide sequences, were annealed at 95 °C for 5 min. and then ramped down to 25 °C to clone into the BbsI-digested pUC57-Simple vector (Addgene ID 51306) under the activity of the T7 promoter.

    Article Title: BRAT1 links Integrator and defective RNA processing with neurodegeneration.
    Article Snippet: The selected CRISPR guide oligonucleotide pairs were annealed and extended into a 98-mer double-stranded fragment using Phusion polymerase (Sigma) and subcloned into the guide RNA cloning vector (Addgene; 41824) using Gibson Assembly (NEB). .. For gene editing, human U2OS cells were co-transfected by the appropriate guide oligonucleotide duplex and a Cas9 expression construct (Addgene; 41815) using Lipofectamine LTX (Life Technologies). .. Twenty-four hours later, the transfected cells were selected in amedium containing 0.5mg/ml G418 (Roche) for 5 days.

    Construct:

    Article Title: Long poly(A) plasmids and methods for introduction of long poly(A) sequences into the plasmid
    Article Snippet: .. Cas9 expression construct was obtained from Addgene (plasmid #41815). ..

    Article Title: Uncoupling of Akt and mTOR signaling drives resistance to Akt inhibition in PTEN loss prostate cancers.
    Article Snippet: .. Competitive cellular growth validation assay The Cas9 expression construct (Addgene, 52962) was transfected into 293 T cells using Lipofectamine 2000 (Invitrogen, 11668- 500) to produce lentiviruses. ..

    Article Title: Uncoupling of Akt and mTOR signaling drives resistance to Akt inhibition in PTEN loss prostate cancers
    Article Snippet: .. The Cas9 expression construct (Addgene, 52962) was transfected into 293 T cells using Lipofectamine 2000 (Invitrogen, 11668-500) to produce lentiviruses. ..

    Article Title: BRAT1 links Integrator and defective RNA processing with neurodegeneration
    Article Snippet: The selected CRISPR guide oligonucleotide pairs were annealed and extended into a 98-mer double-stranded fragment using Phusion polymerase (Sigma) and subcloned into the guide RNA cloning vector (Addgene; 41824) using Gibson Assembly (NEB). .. For gene editing, human U2OS cells were co-transfected by the appropriate guide oligonucleotide duplex and a Cas9 expression construct (Addgene; 41815) using Lipofectamine LTX (Life Technologies). .. Twenty-four hours later, the transfected cells were selected in a medium containing 0.5 mg/ml G418 (Roche) for 5 days.

    Article Title: A Well-Controlled BioID Design for Endogenous Bait Proteins.
    Article Snippet: A puromycin selection cassette was incorporated into the BE3 (Addgene, plasmid no. 73021) vector for endogenous mutagenesis purposes (BE3puro) using a linear dsDNA fragment (IDT DNA Technologies, gBlock). gRNA sequences incorporated into a U6-driven expression cassette were ordered as gBlocks (Table S2) prior to blunt-ended ligation in a pCR-Blunt vector (Thermo Fisher Scientific, K2750). .. HCT116 TP53+/T2A‐BirA* cells were generated using a combination of CRISPR/Cas9 and recombinant Adenoassociated virus (rAAV)-mediated template delivery as described before.40,41 Briefly, a TP53 C-terminal targeted gRNA (5′ ACGCACACCUAUUGCAAGCA 3′) was cloned in a Cas9 expression construct (Addgene no. 48139) as DOI: 10.1021/acs.jproteome.8b00367 J. Proteome Res. .. XXXX, XXX, XXX−XXX B described by Ran et al.42 Cells were seeded in a 24-well plate 24 h before transfection with the Cas9 plasmid using FugeneHD (Promega, E2311).

    Article Title: ZAR1 and ZAR2 are required for oocyte meiotic maturation by regulating the maternal transcriptome and mRNA translational activation
    Article Snippet: .. The codon-optimized Cas9 expression construct, Cas9-N-NLS-flag-linker (Addgene No. 44758), was synthesized and inserted into a pST1374 vector as described previously ( ). ..

    Article Title: CRISPR/Cas9-mediated Disruption of Fibroblast Growth Factor 5 in Rabbits Results in a Systemic Long Hair Phenotype by Prolonging Anagen
    Article Snippet: .. Briefly, the Cas9 expression construct (Addgene ID: 48137), which was synthesized and cloned into the vector that was linearized by NotI, was transcribed in vitro while using a mMessage mMachine SP6 TranscriptionKit (Ambion, Austin, the United States) and a RNeasy Mini Kit (Qiagen, Valencia, USA) to purify the mRNA. .. Complementary oligonucleotides, 20-nt guide sequences, were annealed at 95 °C for 5 min. and then ramped down to 25 °C to clone into the BbsI-digested pUC57-Simple vector (Addgene ID 51306) under the activity of the T7 promoter.

    Article Title: BRAT1 links Integrator and defective RNA processing with neurodegeneration.
    Article Snippet: The selected CRISPR guide oligonucleotide pairs were annealed and extended into a 98-mer double-stranded fragment using Phusion polymerase (Sigma) and subcloned into the guide RNA cloning vector (Addgene; 41824) using Gibson Assembly (NEB). .. For gene editing, human U2OS cells were co-transfected by the appropriate guide oligonucleotide duplex and a Cas9 expression construct (Addgene; 41815) using Lipofectamine LTX (Life Technologies). .. Twenty-four hours later, the transfected cells were selected in amedium containing 0.5mg/ml G418 (Roche) for 5 days.

    Plasmid Preparation:

    Article Title: Long poly(A) plasmids and methods for introduction of long poly(A) sequences into the plasmid
    Article Snippet: .. Cas9 expression construct was obtained from Addgene (plasmid #41815). ..

    Article Title: ZAR1 and ZAR2 are required for oocyte meiotic maturation by regulating the maternal transcriptome and mRNA translational activation
    Article Snippet: .. The codon-optimized Cas9 expression construct, Cas9-N-NLS-flag-linker (Addgene No. 44758), was synthesized and inserted into a pST1374 vector as described previously ( ). ..

    Article Title: CRISPR/Cas9-mediated Disruption of Fibroblast Growth Factor 5 in Rabbits Results in a Systemic Long Hair Phenotype by Prolonging Anagen
    Article Snippet: .. Briefly, the Cas9 expression construct (Addgene ID: 48137), which was synthesized and cloned into the vector that was linearized by NotI, was transcribed in vitro while using a mMessage mMachine SP6 TranscriptionKit (Ambion, Austin, the United States) and a RNeasy Mini Kit (Qiagen, Valencia, USA) to purify the mRNA. .. Complementary oligonucleotides, 20-nt guide sequences, were annealed at 95 °C for 5 min. and then ramped down to 25 °C to clone into the BbsI-digested pUC57-Simple vector (Addgene ID 51306) under the activity of the T7 promoter.

    Biomarker Discovery:

    Article Title: Uncoupling of Akt and mTOR signaling drives resistance to Akt inhibition in PTEN loss prostate cancers.
    Article Snippet: .. Competitive cellular growth validation assay The Cas9 expression construct (Addgene, 52962) was transfected into 293 T cells using Lipofectamine 2000 (Invitrogen, 11668- 500) to produce lentiviruses. ..

    Transfection:

    Article Title: Uncoupling of Akt and mTOR signaling drives resistance to Akt inhibition in PTEN loss prostate cancers.
    Article Snippet: .. Competitive cellular growth validation assay The Cas9 expression construct (Addgene, 52962) was transfected into 293 T cells using Lipofectamine 2000 (Invitrogen, 11668- 500) to produce lentiviruses. ..

    Article Title: Uncoupling of Akt and mTOR signaling drives resistance to Akt inhibition in PTEN loss prostate cancers
    Article Snippet: .. The Cas9 expression construct (Addgene, 52962) was transfected into 293 T cells using Lipofectamine 2000 (Invitrogen, 11668-500) to produce lentiviruses. ..

    Generated:

    Article Title: A Well-Controlled BioID Design for Endogenous Bait Proteins.
    Article Snippet: A puromycin selection cassette was incorporated into the BE3 (Addgene, plasmid no. 73021) vector for endogenous mutagenesis purposes (BE3puro) using a linear dsDNA fragment (IDT DNA Technologies, gBlock). gRNA sequences incorporated into a U6-driven expression cassette were ordered as gBlocks (Table S2) prior to blunt-ended ligation in a pCR-Blunt vector (Thermo Fisher Scientific, K2750). .. HCT116 TP53+/T2A‐BirA* cells were generated using a combination of CRISPR/Cas9 and recombinant Adenoassociated virus (rAAV)-mediated template delivery as described before.40,41 Briefly, a TP53 C-terminal targeted gRNA (5′ ACGCACACCUAUUGCAAGCA 3′) was cloned in a Cas9 expression construct (Addgene no. 48139) as DOI: 10.1021/acs.jproteome.8b00367 J. Proteome Res. .. XXXX, XXX, XXX−XXX B described by Ran et al.42 Cells were seeded in a 24-well plate 24 h before transfection with the Cas9 plasmid using FugeneHD (Promega, E2311).

    CRISPR:

    Article Title: A Well-Controlled BioID Design for Endogenous Bait Proteins.
    Article Snippet: A puromycin selection cassette was incorporated into the BE3 (Addgene, plasmid no. 73021) vector for endogenous mutagenesis purposes (BE3puro) using a linear dsDNA fragment (IDT DNA Technologies, gBlock). gRNA sequences incorporated into a U6-driven expression cassette were ordered as gBlocks (Table S2) prior to blunt-ended ligation in a pCR-Blunt vector (Thermo Fisher Scientific, K2750). .. HCT116 TP53+/T2A‐BirA* cells were generated using a combination of CRISPR/Cas9 and recombinant Adenoassociated virus (rAAV)-mediated template delivery as described before.40,41 Briefly, a TP53 C-terminal targeted gRNA (5′ ACGCACACCUAUUGCAAGCA 3′) was cloned in a Cas9 expression construct (Addgene no. 48139) as DOI: 10.1021/acs.jproteome.8b00367 J. Proteome Res. .. XXXX, XXX, XXX−XXX B described by Ran et al.42 Cells were seeded in a 24-well plate 24 h before transfection with the Cas9 plasmid using FugeneHD (Promega, E2311).

    Recombinant:

    Article Title: A Well-Controlled BioID Design for Endogenous Bait Proteins.
    Article Snippet: A puromycin selection cassette was incorporated into the BE3 (Addgene, plasmid no. 73021) vector for endogenous mutagenesis purposes (BE3puro) using a linear dsDNA fragment (IDT DNA Technologies, gBlock). gRNA sequences incorporated into a U6-driven expression cassette were ordered as gBlocks (Table S2) prior to blunt-ended ligation in a pCR-Blunt vector (Thermo Fisher Scientific, K2750). .. HCT116 TP53+/T2A‐BirA* cells were generated using a combination of CRISPR/Cas9 and recombinant Adenoassociated virus (rAAV)-mediated template delivery as described before.40,41 Briefly, a TP53 C-terminal targeted gRNA (5′ ACGCACACCUAUUGCAAGCA 3′) was cloned in a Cas9 expression construct (Addgene no. 48139) as DOI: 10.1021/acs.jproteome.8b00367 J. Proteome Res. .. XXXX, XXX, XXX−XXX B described by Ran et al.42 Cells were seeded in a 24-well plate 24 h before transfection with the Cas9 plasmid using FugeneHD (Promega, E2311).

    Virus:

    Article Title: A Well-Controlled BioID Design for Endogenous Bait Proteins.
    Article Snippet: A puromycin selection cassette was incorporated into the BE3 (Addgene, plasmid no. 73021) vector for endogenous mutagenesis purposes (BE3puro) using a linear dsDNA fragment (IDT DNA Technologies, gBlock). gRNA sequences incorporated into a U6-driven expression cassette were ordered as gBlocks (Table S2) prior to blunt-ended ligation in a pCR-Blunt vector (Thermo Fisher Scientific, K2750). .. HCT116 TP53+/T2A‐BirA* cells were generated using a combination of CRISPR/Cas9 and recombinant Adenoassociated virus (rAAV)-mediated template delivery as described before.40,41 Briefly, a TP53 C-terminal targeted gRNA (5′ ACGCACACCUAUUGCAAGCA 3′) was cloned in a Cas9 expression construct (Addgene no. 48139) as DOI: 10.1021/acs.jproteome.8b00367 J. Proteome Res. .. XXXX, XXX, XXX−XXX B described by Ran et al.42 Cells were seeded in a 24-well plate 24 h before transfection with the Cas9 plasmid using FugeneHD (Promega, E2311).

    Clone Assay:

    Article Title: A Well-Controlled BioID Design for Endogenous Bait Proteins.
    Article Snippet: A puromycin selection cassette was incorporated into the BE3 (Addgene, plasmid no. 73021) vector for endogenous mutagenesis purposes (BE3puro) using a linear dsDNA fragment (IDT DNA Technologies, gBlock). gRNA sequences incorporated into a U6-driven expression cassette were ordered as gBlocks (Table S2) prior to blunt-ended ligation in a pCR-Blunt vector (Thermo Fisher Scientific, K2750). .. HCT116 TP53+/T2A‐BirA* cells were generated using a combination of CRISPR/Cas9 and recombinant Adenoassociated virus (rAAV)-mediated template delivery as described before.40,41 Briefly, a TP53 C-terminal targeted gRNA (5′ ACGCACACCUAUUGCAAGCA 3′) was cloned in a Cas9 expression construct (Addgene no. 48139) as DOI: 10.1021/acs.jproteome.8b00367 J. Proteome Res. .. XXXX, XXX, XXX−XXX B described by Ran et al.42 Cells were seeded in a 24-well plate 24 h before transfection with the Cas9 plasmid using FugeneHD (Promega, E2311).

    Article Title: CRISPR/Cas9-mediated Disruption of Fibroblast Growth Factor 5 in Rabbits Results in a Systemic Long Hair Phenotype by Prolonging Anagen
    Article Snippet: .. Briefly, the Cas9 expression construct (Addgene ID: 48137), which was synthesized and cloned into the vector that was linearized by NotI, was transcribed in vitro while using a mMessage mMachine SP6 TranscriptionKit (Ambion, Austin, the United States) and a RNeasy Mini Kit (Qiagen, Valencia, USA) to purify the mRNA. .. Complementary oligonucleotides, 20-nt guide sequences, were annealed at 95 °C for 5 min. and then ramped down to 25 °C to clone into the BbsI-digested pUC57-Simple vector (Addgene ID 51306) under the activity of the T7 promoter.

    Synthesized:

    Article Title: ZAR1 and ZAR2 are required for oocyte meiotic maturation by regulating the maternal transcriptome and mRNA translational activation
    Article Snippet: .. The codon-optimized Cas9 expression construct, Cas9-N-NLS-flag-linker (Addgene No. 44758), was synthesized and inserted into a pST1374 vector as described previously ( ). ..

    Article Title: CRISPR/Cas9-mediated Disruption of Fibroblast Growth Factor 5 in Rabbits Results in a Systemic Long Hair Phenotype by Prolonging Anagen
    Article Snippet: .. Briefly, the Cas9 expression construct (Addgene ID: 48137), which was synthesized and cloned into the vector that was linearized by NotI, was transcribed in vitro while using a mMessage mMachine SP6 TranscriptionKit (Ambion, Austin, the United States) and a RNeasy Mini Kit (Qiagen, Valencia, USA) to purify the mRNA. .. Complementary oligonucleotides, 20-nt guide sequences, were annealed at 95 °C for 5 min. and then ramped down to 25 °C to clone into the BbsI-digested pUC57-Simple vector (Addgene ID 51306) under the activity of the T7 promoter.

    In Vitro:

    Article Title: CRISPR/Cas9-mediated Disruption of Fibroblast Growth Factor 5 in Rabbits Results in a Systemic Long Hair Phenotype by Prolonging Anagen
    Article Snippet: .. Briefly, the Cas9 expression construct (Addgene ID: 48137), which was synthesized and cloned into the vector that was linearized by NotI, was transcribed in vitro while using a mMessage mMachine SP6 TranscriptionKit (Ambion, Austin, the United States) and a RNeasy Mini Kit (Qiagen, Valencia, USA) to purify the mRNA. .. Complementary oligonucleotides, 20-nt guide sequences, were annealed at 95 °C for 5 min. and then ramped down to 25 °C to clone into the BbsI-digested pUC57-Simple vector (Addgene ID 51306) under the activity of the T7 promoter.



    Similar Products

    94
    Genecopoeia a549 gfp cell construction a549 gfp
    A549 Gfp Cell Construction A549 Gfp, supplied by Genecopoeia, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cas9+expression+construct/Human+cell+line+A549+stably+expressing+CRISPR+Cas9%2C+AAVS1+inserted%2C+single+clone/pm38970789-275-1-24
    Average 94 stars, based on 1 article reviews
    a549 gfp cell construction a549 gfp - by Bioz Stars, 2026-09
    94/100 stars
      Buy from Supplier

    90
    Genechem cas9-expressing construct
    Cas9 Expressing Construct, supplied by Genechem, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cas9+expression+construct/lentivirus/pmc10098041__pwac011_suppl_supplementary_data-32-16-17
    Average 90 stars, based on 1 article reviews
    cas9-expressing construct - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    96
    Addgene inc inducible cas9 expression construct pcw cas9
    Inducible Cas9 Expression Construct Pcw Cas9, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cas9+expression+construct/pCW-Cas9+(Plasmid+%2350661)/pmc10089214__pnas__2218330120__sapp-27-8-13
    Average 96 stars, based on 1 article reviews
    inducible cas9 expression construct pcw cas9 - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    96
    Addgene inc cas9 expression construct
    ( A ) Plot of the candidate genes from <t>CRISPR-Cas9</t> knockout (KO) screen in LNCaP cells treated with 450 nM ipatasertib on day 18. ( B ) Top genes identified from the CRISPR-Cas9 KO screen on day 18 (ipatasertib-treated LNCaP cells compared to DMSO-treated cells). ( C ) TSC2-KO LNCaP cells were subjected to a 4-hour treatment with either DMSO or 500 nM ipatasertib. Expression levels of downstream targets in the PI3K pathway were evaluated using Western Blot analysis. ( D and E ) Outcomes of a competition assay involving four candidate genes in LNCaP cells. Cells were transduced with lentivirus carrying sgNT-GFP or sgRNA-GFP targeting the candidate genes, each with two specific sgRNAs. Following transduction, cells were treated with either DMSO or 500 nM ipatasertib. The ratio of GFP + cells was normalized to the DMSO treatment group. The data represent the results of three independent experiments ( n = 3). ( F ) LNCaP, CWR22Pc-EP-sgPTEN, and PCa12, each stably expressing sgNT or sgNPRL3, were subjected to treatment with either ipatasertib (500 nM) or DMSO. Cell viability on day 7 was assessed. ( G ) WT, TSC2-KO, or NPRL3-KO LNCaP cells were exposed to 6 hours of starvation and a 4-hour treatment with either DMSO or 500 nM ipatasertib. Following this, cells were stimulated with or without amino acids for 10 min. The expression levels of downstream targets in the PI3K pathway were evaluated using Western Blot analysis {* P < 0.05, ** P < 0.01, and **** P < 0.0001; [(D) to (F)] Welch’s t test; error bar represents ±SEM}.
    Cas9 Expression Construct, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cas9+expression+construct/lentiCas9-Blast+(Plasmid+%2352962)/pmc11804928-183-1-4
    Average 96 stars, based on 1 article reviews
    cas9 expression construct - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    90
    Addgene inc lentivirus encoding a construct that constitutively expresses s. pyogenes cas9
    ( A ) Plot of the candidate genes from <t>CRISPR-Cas9</t> knockout (KO) screen in LNCaP cells treated with 450 nM ipatasertib on day 18. ( B ) Top genes identified from the CRISPR-Cas9 KO screen on day 18 (ipatasertib-treated LNCaP cells compared to DMSO-treated cells). ( C ) TSC2-KO LNCaP cells were subjected to a 4-hour treatment with either DMSO or 500 nM ipatasertib. Expression levels of downstream targets in the PI3K pathway were evaluated using Western Blot analysis. ( D and E ) Outcomes of a competition assay involving four candidate genes in LNCaP cells. Cells were transduced with lentivirus carrying sgNT-GFP or sgRNA-GFP targeting the candidate genes, each with two specific sgRNAs. Following transduction, cells were treated with either DMSO or 500 nM ipatasertib. The ratio of GFP + cells was normalized to the DMSO treatment group. The data represent the results of three independent experiments ( n = 3). ( F ) LNCaP, CWR22Pc-EP-sgPTEN, and PCa12, each stably expressing sgNT or sgNPRL3, were subjected to treatment with either ipatasertib (500 nM) or DMSO. Cell viability on day 7 was assessed. ( G ) WT, TSC2-KO, or NPRL3-KO LNCaP cells were exposed to 6 hours of starvation and a 4-hour treatment with either DMSO or 500 nM ipatasertib. Following this, cells were stimulated with or without amino acids for 10 min. The expression levels of downstream targets in the PI3K pathway were evaluated using Western Blot analysis {* P < 0.05, ** P < 0.01, and **** P < 0.0001; [(D) to (F)] Welch’s t test; error bar represents ±SEM}.
    Lentivirus Encoding A Construct That Constitutively Expresses S. Pyogenes Cas9, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cas9+expression+construct/px330+u6+chimeric+bb+cbh+hspcas9/pm39142279-980-25-40
    Average 90 stars, based on 1 article reviews
    lentivirus encoding a construct that constitutively expresses s. pyogenes cas9 - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    90
    VectorBuilder GmbH lentivirus plasmids expressing both cas9:neo and fdx2 sgrnas and appropriate control constructs
    ( A ) Plot of the candidate genes from <t>CRISPR-Cas9</t> knockout (KO) screen in LNCaP cells treated with 450 nM ipatasertib on day 18. ( B ) Top genes identified from the CRISPR-Cas9 KO screen on day 18 (ipatasertib-treated LNCaP cells compared to DMSO-treated cells). ( C ) TSC2-KO LNCaP cells were subjected to a 4-hour treatment with either DMSO or 500 nM ipatasertib. Expression levels of downstream targets in the PI3K pathway were evaluated using Western Blot analysis. ( D and E ) Outcomes of a competition assay involving four candidate genes in LNCaP cells. Cells were transduced with lentivirus carrying sgNT-GFP or sgRNA-GFP targeting the candidate genes, each with two specific sgRNAs. Following transduction, cells were treated with either DMSO or 500 nM ipatasertib. The ratio of GFP + cells was normalized to the DMSO treatment group. The data represent the results of three independent experiments ( n = 3). ( F ) LNCaP, CWR22Pc-EP-sgPTEN, and PCa12, each stably expressing sgNT or sgNPRL3, were subjected to treatment with either ipatasertib (500 nM) or DMSO. Cell viability on day 7 was assessed. ( G ) WT, TSC2-KO, or NPRL3-KO LNCaP cells were exposed to 6 hours of starvation and a 4-hour treatment with either DMSO or 500 nM ipatasertib. Following this, cells were stimulated with or without amino acids for 10 min. The expression levels of downstream targets in the PI3K pathway were evaluated using Western Blot analysis {* P < 0.05, ** P < 0.01, and **** P < 0.0001; [(D) to (F)] Welch’s t test; error bar represents ±SEM}.
    Lentivirus Plasmids Expressing Both Cas9:Neo And Fdx2 Sgrnas And Appropriate Control Constructs, supplied by VectorBuilder GmbH, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cas9+expression+construct/lentiviral+vectors/pmc11414659-242-4-15
    Average 90 stars, based on 1 article reviews
    lentivirus plasmids expressing both cas9:neo and fdx2 sgrnas and appropriate control constructs - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    96
    Addgene inc lentiviral cas9 expression construct lenticas9 blast
    Fig. 2 Oncogene exposure transforms induced hepatocytes but not control fibroblasts. A Phase contrast microscope images showing the phenotype and morphology of the cells in the course of conversion of fibroblasts to iHeps at different times points after transduction with a cocktail of three TFs HNF1A, HNF4A and FOXA3 [36]. B Generation of highly proliferative iHep cells by transducing iHeps with two pools of liver cancer-specific oncogenic drivers, a list of xenograft experiments in nude mice that were used to test the tumorigenicity of different conditions, and mutation rates of the oncogenic drivers as reported in the COSMIC database for HCC and MYC amplification as reported in [43]. CMT pool contains three oncogenes CTNNB1T41A, MYC, and TERT, and CMT + sgTP53 pool contains the same oncogenes along with constructs for TP53 inactivation by <t>CRISPR-Cas9.</t> Phase contrast microscope images showing the phenotype and morphology of the cells. Oncogenes are co-transduced with fluorescent reporter mCherry for the detection of transduced cells. Oncogene transduction to fibroblasts fails to transform the cells, passaging of oncogene-expressing fibroblasts results in cellular senescence as demonstrated by β-galactosidase staining and loss of mCherry-positive oncogene-expressing cells from the fibroblast population. iHeps maintained in defined culture medium become senescent around week four of transdifferentiation although they can survive in culture for several weeks after that if not passaged. Passaging of iHeps without oncogenes results in apoptosis after few passages. Scale bar 1000 μm unless otherwise specified.
    Lentiviral Cas9 Expression Construct Lenticas9 Blast, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cas9+expression+construct/lentiCas9-Blast+(Plasmid+%2352962)/pm34302118-213-5-41
    Average 96 stars, based on 1 article reviews
    lentiviral cas9 expression construct lenticas9 blast - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    93
    Addgene inc s muelleri cas9 121541 expression constructs
    AcrIIA28 directly binds to only SpyCas9 via the REC3 domain. ( A ) Interaction analysis between AcrIIA28 and various Cas9s by SEC followed by SDS-PAGE analysis. SDS-PAGE gels are produced by loading one of the main fractions from the <t>Cas9</t> sample with (+AcrIIA28) or without (-AcrIIA28) AcrIIA28. The black arrow indicates the co-migration of AcrIIA28 with Cas9. ( B ) Interaction analysis between AcrIIA28 and SpyCas9 by SEC followed by SDS-PAGE analysis. SEC profiles produced by AcrIIA28 (black line), SpyCas9 (blue line), and the mixture of AcrIIA28 and SpyCas9 (red line) are shown. SDS-PAGE gels produced by SpyCas9 alone and the mixture of AcrIIA28 and SpyCas9 are provided under the SEC profile. The red dot box on the SDS-PAGE gel indicates the co-migrated AcrIIA28 bands. Black lines indicate loaded fractions of SpyCas9/AcrIIA28 mixture for SDS-PAGE. M indicates protein size marker. ( C ) Native PAGE of SpyCas9, AcrIIA28 and SpyCas9 + AcrIIA28 mixture. The red arrow indicates a newly produced band that a complex might form. ( D ) Domain organization of SpyCas9. ( E ) Interaction analysis between AcrIIA28 and SpyREC3 domain by SEC. SEC profiles produced by AcrIIA28 (black line), SpyREC3 domain (blue line), and the mixture of AcrIIA28 and SpyREC3 domain (red line) are shown. SDS-PAGE gel produced by the AcrIIA28 and SpyREC3 domain mixture is provided under the SEC profile. Loaded fractions for SDS-PAGE were indicated by the black bar. The black arrow indicated peak movement on the SEC profile. ( F ) ITC experiment showing titration of AcrIIA28 into a SpyREC3 solution. The raw calorimetric titration data are shown in the upper panel, and experimental fitting of the data to a single site interaction model is shown in the lower panel. ( G ) An in vitro anti-CRISPR activity assay of AcrIIA28 against SauCas9. Polyacrylamide gels (4%) were stained with SYBR GOLD. The numbers indicate the order in which the agents were added to the reaction: one represents the sample added first, and four represents the sample added last. In the enzyme reaction, + and – indicate added and not added, respectively. All the experiments for figure were performed three times with similar results.
    S Muelleri Cas9 121541 Expression Constructs, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cas9+expression+construct/pEJS1027-pMCSG7-SmuCas9+(Plasmid+%23121541)/pmc11194106-87-14-23
    Average 93 stars, based on 1 article reviews
    s muelleri cas9 121541 expression constructs - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    93
    Addgene inc s mueleri cas9 121541 expression constructs
    Figure 4. AcrIIA28 directly binds to only SpyCas9 via the REC3 domain. ( A ) Interaction analysis between AcrIIA28 and various Cas9s by SEC followed by SDS-PAGE analysis. SDS-PAGE gels are produced by loading one of the main fractions from the <t>Cas9</t> sample with (+AcrIIA28) or without (-AcrIIA28) A crIIA28. T he black arro w indicates the co-migration of A crIIA28 with Cas9. ( B ) Interaction analy sis betw een A crIIA28 and Sp yCas9 b y SEC f ollo w ed b y SDS-PAGE analysis. SEC profiles produced by AcrIIA28 (black line), SpyCas9 (blue line), and the mixture of AcrIIA28 and SpyCas9 (red line) are shown. SDS-PAGE gels produced by SpyCas9 alone and the mixture of AcrIIA28 and SpyCas9 are provided under the SEC profile. The red dot box on the SDS-PAGE gel indicates the co-migrated AcrIIA28 bands. Black lines indicate loaded fractions of SpyCas9 / AcrIIA28 mixture for SDS-PAGE. M indicates protein size marker. ( C ) Native PAGE of SpyCas9, AcrIIA28 and SpyCas9 + AcrIIA28 mixture. The red arrow indicates a newly produced band that a complex might form. ( D ) Domain organization of SpyCas9. ( E ) Interaction analysis between AcrIIA28 and SpyREC3 domain by SEC. SEC profiles produced by AcrIIA28 (black line), SpyREC3 domain (blue line), and the mixture of AcrIIA28 and SpyREC3 domain (red line) are shown. SDS-PAGE gel produced by the AcrIIA28 and SpyREC3 domain mixture is provided under the SEC profile. Loaded fractions for SDS-PAGE were indicated by the black bar. The black arrow indicated peak movement on the SEC profile. ( F ) ITC experiment showing titration of AcrIIA28 into a SpyREC3 solution. The raw calorimetric titration data are shown in the upper panel, and experimental fitting of the data to a single site interaction model is shown in the lo w er panel. ( G ) An in vitro anti-CRISPR activity assay of AcrIIA28 against SauCas9. Polyacrylamide gels (4%) were stained with SYBR GOLD. The numbers indicate the order in which the agents were added to the reaction: one represents the sample added first, and four represents the sample added last. In the enzyme reaction, + and – indicate added and not added, respectively. All the experiments for figure 4 were performed three times with similar results.
    S Mueleri Cas9 121541 Expression Constructs, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cas9+expression+construct/pEJS1027-pMCSG7-SmuCas9+(Plasmid+%23121541)/pm38726868-61-14-23
    Average 93 stars, based on 1 article reviews
    s mueleri cas9 121541 expression constructs - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    Image Search Results


    ( A ) Plot of the candidate genes from CRISPR-Cas9 knockout (KO) screen in LNCaP cells treated with 450 nM ipatasertib on day 18. ( B ) Top genes identified from the CRISPR-Cas9 KO screen on day 18 (ipatasertib-treated LNCaP cells compared to DMSO-treated cells). ( C ) TSC2-KO LNCaP cells were subjected to a 4-hour treatment with either DMSO or 500 nM ipatasertib. Expression levels of downstream targets in the PI3K pathway were evaluated using Western Blot analysis. ( D and E ) Outcomes of a competition assay involving four candidate genes in LNCaP cells. Cells were transduced with lentivirus carrying sgNT-GFP or sgRNA-GFP targeting the candidate genes, each with two specific sgRNAs. Following transduction, cells were treated with either DMSO or 500 nM ipatasertib. The ratio of GFP + cells was normalized to the DMSO treatment group. The data represent the results of three independent experiments ( n = 3). ( F ) LNCaP, CWR22Pc-EP-sgPTEN, and PCa12, each stably expressing sgNT or sgNPRL3, were subjected to treatment with either ipatasertib (500 nM) or DMSO. Cell viability on day 7 was assessed. ( G ) WT, TSC2-KO, or NPRL3-KO LNCaP cells were exposed to 6 hours of starvation and a 4-hour treatment with either DMSO or 500 nM ipatasertib. Following this, cells were stimulated with or without amino acids for 10 min. The expression levels of downstream targets in the PI3K pathway were evaluated using Western Blot analysis {* P < 0.05, ** P < 0.01, and **** P < 0.0001; [(D) to (F)] Welch’s t test; error bar represents ±SEM}.

    Journal: Science Advances

    Article Title: Uncoupling of Akt and mTOR signaling drives resistance to Akt inhibition in PTEN loss prostate cancers

    doi: 10.1126/sciadv.adq3802

    Figure Lengend Snippet: ( A ) Plot of the candidate genes from CRISPR-Cas9 knockout (KO) screen in LNCaP cells treated with 450 nM ipatasertib on day 18. ( B ) Top genes identified from the CRISPR-Cas9 KO screen on day 18 (ipatasertib-treated LNCaP cells compared to DMSO-treated cells). ( C ) TSC2-KO LNCaP cells were subjected to a 4-hour treatment with either DMSO or 500 nM ipatasertib. Expression levels of downstream targets in the PI3K pathway were evaluated using Western Blot analysis. ( D and E ) Outcomes of a competition assay involving four candidate genes in LNCaP cells. Cells were transduced with lentivirus carrying sgNT-GFP or sgRNA-GFP targeting the candidate genes, each with two specific sgRNAs. Following transduction, cells were treated with either DMSO or 500 nM ipatasertib. The ratio of GFP + cells was normalized to the DMSO treatment group. The data represent the results of three independent experiments ( n = 3). ( F ) LNCaP, CWR22Pc-EP-sgPTEN, and PCa12, each stably expressing sgNT or sgNPRL3, were subjected to treatment with either ipatasertib (500 nM) or DMSO. Cell viability on day 7 was assessed. ( G ) WT, TSC2-KO, or NPRL3-KO LNCaP cells were exposed to 6 hours of starvation and a 4-hour treatment with either DMSO or 500 nM ipatasertib. Following this, cells were stimulated with or without amino acids for 10 min. The expression levels of downstream targets in the PI3K pathway were evaluated using Western Blot analysis {* P < 0.05, ** P < 0.01, and **** P < 0.0001; [(D) to (F)] Welch’s t test; error bar represents ±SEM}.

    Article Snippet: The Cas9 expression construct (Addgene, 52962) was transfected into 293 T cells using Lipofectamine 2000 (Invitrogen, 11668-500) to produce lentiviruses.

    Techniques: CRISPR, Knock-Out, Expressing, Western Blot, Competitive Binding Assay, Transduction, Stable Transfection

    Fig. 2 Oncogene exposure transforms induced hepatocytes but not control fibroblasts. A Phase contrast microscope images showing the phenotype and morphology of the cells in the course of conversion of fibroblasts to iHeps at different times points after transduction with a cocktail of three TFs HNF1A, HNF4A and FOXA3 [36]. B Generation of highly proliferative iHep cells by transducing iHeps with two pools of liver cancer-specific oncogenic drivers, a list of xenograft experiments in nude mice that were used to test the tumorigenicity of different conditions, and mutation rates of the oncogenic drivers as reported in the COSMIC database for HCC and MYC amplification as reported in [43]. CMT pool contains three oncogenes CTNNB1T41A, MYC, and TERT, and CMT + sgTP53 pool contains the same oncogenes along with constructs for TP53 inactivation by CRISPR-Cas9. Phase contrast microscope images showing the phenotype and morphology of the cells. Oncogenes are co-transduced with fluorescent reporter mCherry for the detection of transduced cells. Oncogene transduction to fibroblasts fails to transform the cells, passaging of oncogene-expressing fibroblasts results in cellular senescence as demonstrated by β-galactosidase staining and loss of mCherry-positive oncogene-expressing cells from the fibroblast population. iHeps maintained in defined culture medium become senescent around week four of transdifferentiation although they can survive in culture for several weeks after that if not passaged. Passaging of iHeps without oncogenes results in apoptosis after few passages. Scale bar 1000 μm unless otherwise specified.

    Journal: Oncogene

    Article Title: Human cell transformation by combined lineage conversion and oncogene expression.

    doi: 10.1038/s41388-021-01940-0

    Figure Lengend Snippet: Fig. 2 Oncogene exposure transforms induced hepatocytes but not control fibroblasts. A Phase contrast microscope images showing the phenotype and morphology of the cells in the course of conversion of fibroblasts to iHeps at different times points after transduction with a cocktail of three TFs HNF1A, HNF4A and FOXA3 [36]. B Generation of highly proliferative iHep cells by transducing iHeps with two pools of liver cancer-specific oncogenic drivers, a list of xenograft experiments in nude mice that were used to test the tumorigenicity of different conditions, and mutation rates of the oncogenic drivers as reported in the COSMIC database for HCC and MYC amplification as reported in [43]. CMT pool contains three oncogenes CTNNB1T41A, MYC, and TERT, and CMT + sgTP53 pool contains the same oncogenes along with constructs for TP53 inactivation by CRISPR-Cas9. Phase contrast microscope images showing the phenotype and morphology of the cells. Oncogenes are co-transduced with fluorescent reporter mCherry for the detection of transduced cells. Oncogene transduction to fibroblasts fails to transform the cells, passaging of oncogene-expressing fibroblasts results in cellular senescence as demonstrated by β-galactosidase staining and loss of mCherry-positive oncogene-expressing cells from the fibroblast population. iHeps maintained in defined culture medium become senescent around week four of transdifferentiation although they can survive in culture for several weeks after that if not passaged. Passaging of iHeps without oncogenes results in apoptosis after few passages. Scale bar 1000 μm unless otherwise specified.

    Article Snippet: Expression construct for mCherry (#36084), lentiviral Cas9 expression construct LentiCas9-Blast (#52962), a cloning backbone lentiGuide-Puro (#52963), and the constructs for neuronal conversion (Tet-O-FUW-Ascl1, #27150; TetO-FUW-Brn2, #27151; Tet-O-FUW-Myt1l, #27152; Tet-O-FUW-NeuroD1, # 30129; pTetO-Ngn2-Puro, #52047; Tet-O-FUW-EGFP, # 30130; FUW-M2rtTA, #20342) were obtained from Addgene (Watertown, MA).

    Techniques: Control, Microscopy, Transduction, Mutagenesis, Construct, CRISPR, Passaging, Expressing, Staining

    AcrIIA28 directly binds to only SpyCas9 via the REC3 domain. ( A ) Interaction analysis between AcrIIA28 and various Cas9s by SEC followed by SDS-PAGE analysis. SDS-PAGE gels are produced by loading one of the main fractions from the Cas9 sample with (+AcrIIA28) or without (-AcrIIA28) AcrIIA28. The black arrow indicates the co-migration of AcrIIA28 with Cas9. ( B ) Interaction analysis between AcrIIA28 and SpyCas9 by SEC followed by SDS-PAGE analysis. SEC profiles produced by AcrIIA28 (black line), SpyCas9 (blue line), and the mixture of AcrIIA28 and SpyCas9 (red line) are shown. SDS-PAGE gels produced by SpyCas9 alone and the mixture of AcrIIA28 and SpyCas9 are provided under the SEC profile. The red dot box on the SDS-PAGE gel indicates the co-migrated AcrIIA28 bands. Black lines indicate loaded fractions of SpyCas9/AcrIIA28 mixture for SDS-PAGE. M indicates protein size marker. ( C ) Native PAGE of SpyCas9, AcrIIA28 and SpyCas9 + AcrIIA28 mixture. The red arrow indicates a newly produced band that a complex might form. ( D ) Domain organization of SpyCas9. ( E ) Interaction analysis between AcrIIA28 and SpyREC3 domain by SEC. SEC profiles produced by AcrIIA28 (black line), SpyREC3 domain (blue line), and the mixture of AcrIIA28 and SpyREC3 domain (red line) are shown. SDS-PAGE gel produced by the AcrIIA28 and SpyREC3 domain mixture is provided under the SEC profile. Loaded fractions for SDS-PAGE were indicated by the black bar. The black arrow indicated peak movement on the SEC profile. ( F ) ITC experiment showing titration of AcrIIA28 into a SpyREC3 solution. The raw calorimetric titration data are shown in the upper panel, and experimental fitting of the data to a single site interaction model is shown in the lower panel. ( G ) An in vitro anti-CRISPR activity assay of AcrIIA28 against SauCas9. Polyacrylamide gels (4%) were stained with SYBR GOLD. The numbers indicate the order in which the agents were added to the reaction: one represents the sample added first, and four represents the sample added last. In the enzyme reaction, + and – indicate added and not added, respectively. All the experiments for figure were performed three times with similar results.

    Journal: Nucleic Acids Research

    Article Title: AcrIIA28 is a metalloprotein that specifically inhibits targeted-DNA loading to SpyCas9 by binding to the REC3 domain

    doi: 10.1093/nar/gkae357

    Figure Lengend Snippet: AcrIIA28 directly binds to only SpyCas9 via the REC3 domain. ( A ) Interaction analysis between AcrIIA28 and various Cas9s by SEC followed by SDS-PAGE analysis. SDS-PAGE gels are produced by loading one of the main fractions from the Cas9 sample with (+AcrIIA28) or without (-AcrIIA28) AcrIIA28. The black arrow indicates the co-migration of AcrIIA28 with Cas9. ( B ) Interaction analysis between AcrIIA28 and SpyCas9 by SEC followed by SDS-PAGE analysis. SEC profiles produced by AcrIIA28 (black line), SpyCas9 (blue line), and the mixture of AcrIIA28 and SpyCas9 (red line) are shown. SDS-PAGE gels produced by SpyCas9 alone and the mixture of AcrIIA28 and SpyCas9 are provided under the SEC profile. The red dot box on the SDS-PAGE gel indicates the co-migrated AcrIIA28 bands. Black lines indicate loaded fractions of SpyCas9/AcrIIA28 mixture for SDS-PAGE. M indicates protein size marker. ( C ) Native PAGE of SpyCas9, AcrIIA28 and SpyCas9 + AcrIIA28 mixture. The red arrow indicates a newly produced band that a complex might form. ( D ) Domain organization of SpyCas9. ( E ) Interaction analysis between AcrIIA28 and SpyREC3 domain by SEC. SEC profiles produced by AcrIIA28 (black line), SpyREC3 domain (blue line), and the mixture of AcrIIA28 and SpyREC3 domain (red line) are shown. SDS-PAGE gel produced by the AcrIIA28 and SpyREC3 domain mixture is provided under the SEC profile. Loaded fractions for SDS-PAGE were indicated by the black bar. The black arrow indicated peak movement on the SEC profile. ( F ) ITC experiment showing titration of AcrIIA28 into a SpyREC3 solution. The raw calorimetric titration data are shown in the upper panel, and experimental fitting of the data to a single site interaction model is shown in the lower panel. ( G ) An in vitro anti-CRISPR activity assay of AcrIIA28 against SauCas9. Polyacrylamide gels (4%) were stained with SYBR GOLD. The numbers indicate the order in which the agents were added to the reaction: one represents the sample added first, and four represents the sample added last. In the enzyme reaction, + and – indicate added and not added, respectively. All the experiments for figure were performed three times with similar results.

    Article Snippet: The S. pyogenes Cas9 (#62731), N. meningitides Cas9 (#71474), H. parainfluenzae Cas9 (#121540) and S. muelleri Cas9 (#121541) expression constructs were purchased from Addgene.

    Techniques: SDS Page, Produced, Migration, Marker, Clear Native PAGE, Titration, In Vitro, CRISPR, Activity Assay, Staining

    Biding mode analysis indicated that the AcrIIA28 residues K7, W45 and S81 are critical for AcrIIA28 binding to Cas9. ( A ) The docking model of AcrIIA28 docked onto SpyCas9. Cas9 and docked AcrIIA28 (orange color) are presented by surface and cartoon models, respectively. ( B ) Analysis of PPI detail from the docking model of AcrIIA28/SpyCas9 complex. Four PPI regions are independently magnified. The residues involved in the interaction are labeled. ( C ) Interaction analysis between SpyCas9 and various tentative PPI-disrupting mutants of AcrIIA28 by SEC followed by SDS-PAGE analysis. SDS-PAGE gels produced by loading one of the main fractions from the SpyCas9 sample with wild-type or various mutants are shown. A black arrow indicates acrIIA28 mutants that co-migrated with SpyCas9. ( D ) The bar chart shows the quantified intensity of the co-eluted AcrII28 mutants. Data are presented as the mean ± standard deviation from three independent experiments. ( E ) Interaction analysis between SpyREC3 and three PPI-disrupting mutants (K7D, W45I and S81W) of AcrIIA28 by SEC followed by SDS-PAGE analysis.

    Journal: Nucleic Acids Research

    Article Title: AcrIIA28 is a metalloprotein that specifically inhibits targeted-DNA loading to SpyCas9 by binding to the REC3 domain

    doi: 10.1093/nar/gkae357

    Figure Lengend Snippet: Biding mode analysis indicated that the AcrIIA28 residues K7, W45 and S81 are critical for AcrIIA28 binding to Cas9. ( A ) The docking model of AcrIIA28 docked onto SpyCas9. Cas9 and docked AcrIIA28 (orange color) are presented by surface and cartoon models, respectively. ( B ) Analysis of PPI detail from the docking model of AcrIIA28/SpyCas9 complex. Four PPI regions are independently magnified. The residues involved in the interaction are labeled. ( C ) Interaction analysis between SpyCas9 and various tentative PPI-disrupting mutants of AcrIIA28 by SEC followed by SDS-PAGE analysis. SDS-PAGE gels produced by loading one of the main fractions from the SpyCas9 sample with wild-type or various mutants are shown. A black arrow indicates acrIIA28 mutants that co-migrated with SpyCas9. ( D ) The bar chart shows the quantified intensity of the co-eluted AcrII28 mutants. Data are presented as the mean ± standard deviation from three independent experiments. ( E ) Interaction analysis between SpyREC3 and three PPI-disrupting mutants (K7D, W45I and S81W) of AcrIIA28 by SEC followed by SDS-PAGE analysis.

    Article Snippet: The S. pyogenes Cas9 (#62731), N. meningitides Cas9 (#71474), H. parainfluenzae Cas9 (#121540) and S. muelleri Cas9 (#121541) expression constructs were purchased from Addgene.

    Techniques: Binding Assay, Labeling, SDS Page, Produced, Standard Deviation

    Direct interaction of AcrIIA28 is critical for Cas9 inhibition. ( A ) In vitro target DNA cleavage assay using wild-type Cas9 and various AcrIIA28 mutants. In vitro anti-CRISPR activity assay using various tentative PPI-disrupting mutants of AcrIIA28. In the enzyme reaction, + and – indicate added and not added, respectively. ( B ) Quantitative histogram of anti-Cas9 activity of AcrIIA28 according to (A). The inhibitory activity of wild-type AcrIIA28 was considered to be 100%. Data are presented as the mean ± standard deviation from three independent experiments.

    Journal: Nucleic Acids Research

    Article Title: AcrIIA28 is a metalloprotein that specifically inhibits targeted-DNA loading to SpyCas9 by binding to the REC3 domain

    doi: 10.1093/nar/gkae357

    Figure Lengend Snippet: Direct interaction of AcrIIA28 is critical for Cas9 inhibition. ( A ) In vitro target DNA cleavage assay using wild-type Cas9 and various AcrIIA28 mutants. In vitro anti-CRISPR activity assay using various tentative PPI-disrupting mutants of AcrIIA28. In the enzyme reaction, + and – indicate added and not added, respectively. ( B ) Quantitative histogram of anti-Cas9 activity of AcrIIA28 according to (A). The inhibitory activity of wild-type AcrIIA28 was considered to be 100%. Data are presented as the mean ± standard deviation from three independent experiments.

    Article Snippet: The S. pyogenes Cas9 (#62731), N. meningitides Cas9 (#71474), H. parainfluenzae Cas9 (#121540) and S. muelleri Cas9 (#121541) expression constructs were purchased from Addgene.

    Techniques: Inhibition, In Vitro, DNA Cleavage Assay, CRISPR, Activity Assay, Standard Deviation

    Proposed model of Cas9 inhibition by AcrIIA28. ( A and B ) EMSA analysis of the effect of AcrIIA28 on the binding of target DNA into Cas9. The number next to each protein indicates the order in which the proteins were added to form the complex. The red star indicates the band newly produced by the RNP/DNA complex. The experiments were performed three times with similar results. ( C and D ) An in vitro anti-CRISPR activity assay was used to compare the inhibitory effect of AcrIIA28 when added before (C) or after (D) the target DNA. Polyacrylamide gels (4%) were stained with SYBR GOLD. The amount of AcrIIA28 added to the reaction is indicated. The numbers next to the agents used in the experiment indicate the order in which agents were added to the reaction: one represents the sample added first, and three represents the sample added last. In the enzyme reaction, + and – indicate added and not added, respectively. ( E ) Proposed model of Cas9 inhibition by AcrIIA28.

    Journal: Nucleic Acids Research

    Article Title: AcrIIA28 is a metalloprotein that specifically inhibits targeted-DNA loading to SpyCas9 by binding to the REC3 domain

    doi: 10.1093/nar/gkae357

    Figure Lengend Snippet: Proposed model of Cas9 inhibition by AcrIIA28. ( A and B ) EMSA analysis of the effect of AcrIIA28 on the binding of target DNA into Cas9. The number next to each protein indicates the order in which the proteins were added to form the complex. The red star indicates the band newly produced by the RNP/DNA complex. The experiments were performed three times with similar results. ( C and D ) An in vitro anti-CRISPR activity assay was used to compare the inhibitory effect of AcrIIA28 when added before (C) or after (D) the target DNA. Polyacrylamide gels (4%) were stained with SYBR GOLD. The amount of AcrIIA28 added to the reaction is indicated. The numbers next to the agents used in the experiment indicate the order in which agents were added to the reaction: one represents the sample added first, and three represents the sample added last. In the enzyme reaction, + and – indicate added and not added, respectively. ( E ) Proposed model of Cas9 inhibition by AcrIIA28.

    Article Snippet: The S. pyogenes Cas9 (#62731), N. meningitides Cas9 (#71474), H. parainfluenzae Cas9 (#121540) and S. muelleri Cas9 (#121541) expression constructs were purchased from Addgene.

    Techniques: Inhibition, Binding Assay, Produced, In Vitro, CRISPR, Activity Assay, Staining

    Figure 4. AcrIIA28 directly binds to only SpyCas9 via the REC3 domain. ( A ) Interaction analysis between AcrIIA28 and various Cas9s by SEC followed by SDS-PAGE analysis. SDS-PAGE gels are produced by loading one of the main fractions from the Cas9 sample with (+AcrIIA28) or without (-AcrIIA28) A crIIA28. T he black arro w indicates the co-migration of A crIIA28 with Cas9. ( B ) Interaction analy sis betw een A crIIA28 and Sp yCas9 b y SEC f ollo w ed b y SDS-PAGE analysis. SEC profiles produced by AcrIIA28 (black line), SpyCas9 (blue line), and the mixture of AcrIIA28 and SpyCas9 (red line) are shown. SDS-PAGE gels produced by SpyCas9 alone and the mixture of AcrIIA28 and SpyCas9 are provided under the SEC profile. The red dot box on the SDS-PAGE gel indicates the co-migrated AcrIIA28 bands. Black lines indicate loaded fractions of SpyCas9 / AcrIIA28 mixture for SDS-PAGE. M indicates protein size marker. ( C ) Native PAGE of SpyCas9, AcrIIA28 and SpyCas9 + AcrIIA28 mixture. The red arrow indicates a newly produced band that a complex might form. ( D ) Domain organization of SpyCas9. ( E ) Interaction analysis between AcrIIA28 and SpyREC3 domain by SEC. SEC profiles produced by AcrIIA28 (black line), SpyREC3 domain (blue line), and the mixture of AcrIIA28 and SpyREC3 domain (red line) are shown. SDS-PAGE gel produced by the AcrIIA28 and SpyREC3 domain mixture is provided under the SEC profile. Loaded fractions for SDS-PAGE were indicated by the black bar. The black arrow indicated peak movement on the SEC profile. ( F ) ITC experiment showing titration of AcrIIA28 into a SpyREC3 solution. The raw calorimetric titration data are shown in the upper panel, and experimental fitting of the data to a single site interaction model is shown in the lo w er panel. ( G ) An in vitro anti-CRISPR activity assay of AcrIIA28 against SauCas9. Polyacrylamide gels (4%) were stained with SYBR GOLD. The numbers indicate the order in which the agents were added to the reaction: one represents the sample added first, and four represents the sample added last. In the enzyme reaction, + and – indicate added and not added, respectively. All the experiments for figure 4 were performed three times with similar results.

    Journal: Nucleic acids research

    Article Title: AcrIIA28 is a metalloprotein that specifically inhibits targeted-DNA loading to SpyCas9 by binding to the REC3 domain.

    doi: 10.1093/nar/gkae357

    Figure Lengend Snippet: Figure 4. AcrIIA28 directly binds to only SpyCas9 via the REC3 domain. ( A ) Interaction analysis between AcrIIA28 and various Cas9s by SEC followed by SDS-PAGE analysis. SDS-PAGE gels are produced by loading one of the main fractions from the Cas9 sample with (+AcrIIA28) or without (-AcrIIA28) A crIIA28. T he black arro w indicates the co-migration of A crIIA28 with Cas9. ( B ) Interaction analy sis betw een A crIIA28 and Sp yCas9 b y SEC f ollo w ed b y SDS-PAGE analysis. SEC profiles produced by AcrIIA28 (black line), SpyCas9 (blue line), and the mixture of AcrIIA28 and SpyCas9 (red line) are shown. SDS-PAGE gels produced by SpyCas9 alone and the mixture of AcrIIA28 and SpyCas9 are provided under the SEC profile. The red dot box on the SDS-PAGE gel indicates the co-migrated AcrIIA28 bands. Black lines indicate loaded fractions of SpyCas9 / AcrIIA28 mixture for SDS-PAGE. M indicates protein size marker. ( C ) Native PAGE of SpyCas9, AcrIIA28 and SpyCas9 + AcrIIA28 mixture. The red arrow indicates a newly produced band that a complex might form. ( D ) Domain organization of SpyCas9. ( E ) Interaction analysis between AcrIIA28 and SpyREC3 domain by SEC. SEC profiles produced by AcrIIA28 (black line), SpyREC3 domain (blue line), and the mixture of AcrIIA28 and SpyREC3 domain (red line) are shown. SDS-PAGE gel produced by the AcrIIA28 and SpyREC3 domain mixture is provided under the SEC profile. Loaded fractions for SDS-PAGE were indicated by the black bar. The black arrow indicated peak movement on the SEC profile. ( F ) ITC experiment showing titration of AcrIIA28 into a SpyREC3 solution. The raw calorimetric titration data are shown in the upper panel, and experimental fitting of the data to a single site interaction model is shown in the lo w er panel. ( G ) An in vitro anti-CRISPR activity assay of AcrIIA28 against SauCas9. Polyacrylamide gels (4%) were stained with SYBR GOLD. The numbers indicate the order in which the agents were added to the reaction: one represents the sample added first, and four represents the sample added last. In the enzyme reaction, + and – indicate added and not added, respectively. All the experiments for figure 4 were performed three times with similar results.

    Article Snippet: The S. pyogenes Cas9 (#62731), N. meningitides Cas9 #71474), H. parainfluenzae Cas9 (#121540) and S. mueleri Cas9 (#121541) expression constructs were purchased rom Addgene.

    Techniques: SDS Page, Produced, Migration, Marker, Clear Native PAGE, Titration, In Vitro, CRISPR, Activity Assay, Staining

    Figure 6. Direct interaction of AcrIIA28 is critical for Cas9 inhibition. ( A ) In vitro target DNA cleavage assay using wild-type Cas9 and various AcrIIA28 mutants. In vitro anti-CRISPR activity assay using various tentative PPI-disrupting mutants of AcrIIA28. In the enzyme reaction, + and – indicate added and not added, respectiv ely. ( B ) Quantitativ e histogram of anti-Cas9 activity of A crIIA28 according to (A). T he inhibitory activit y of wild-t ype A crIIA28 w as considered to be 100%. Data are presented as the mean ± standard deviation from three independent experiments.

    Journal: Nucleic acids research

    Article Title: AcrIIA28 is a metalloprotein that specifically inhibits targeted-DNA loading to SpyCas9 by binding to the REC3 domain.

    doi: 10.1093/nar/gkae357

    Figure Lengend Snippet: Figure 6. Direct interaction of AcrIIA28 is critical for Cas9 inhibition. ( A ) In vitro target DNA cleavage assay using wild-type Cas9 and various AcrIIA28 mutants. In vitro anti-CRISPR activity assay using various tentative PPI-disrupting mutants of AcrIIA28. In the enzyme reaction, + and – indicate added and not added, respectiv ely. ( B ) Quantitativ e histogram of anti-Cas9 activity of A crIIA28 according to (A). T he inhibitory activit y of wild-t ype A crIIA28 w as considered to be 100%. Data are presented as the mean ± standard deviation from three independent experiments.

    Article Snippet: The S. pyogenes Cas9 (#62731), N. meningitides Cas9 #71474), H. parainfluenzae Cas9 (#121540) and S. mueleri Cas9 (#121541) expression constructs were purchased rom Addgene.

    Techniques: Inhibition, In Vitro, DNA Cleavage Assay, CRISPR, Activity Assay, Standard Deviation

    Figure 5. Biding mode analysis indicated that the AcrIIA28 residues K7, W45 and S81 are critical for AcrIIA28 binding to Cas9. ( A ) The docking model of A crIIA28 dock ed onto Sp yCas9. Cas9 and dock ed A crIIA28 (orange color) are presented b y surf ace and cartoon models, respectiv ely. ( B ) Analy sis of PPI detail from the docking model of A crIIA28 / Sp yCas9 comple x. Four PPI regions are independently magnified. T he residues in v olv ed in the interaction are labeled. ( C ) Interaction analysis between SpyCas9 and various tentative PPI-disrupting mutants of AcrIIA28 by SEC followed by SDS-PAGE analysis. SDS-PAGE gels produced by loading one of the main fractions from the SpyCas9 sample with wild-type or various mutants are shown. A black arrow indicates acrIIA28 mutants that co-migrated with SpyCas9. ( D ) The bar chart shows the quantified intensity of the co-eluted AcrII28 mutants. Data are presented as the mean ± standard deviation from three independent experiments. ( E ) Interaction analysis between SpyREC3 and three PPI-disrupting mutants (K7D, W45I and S81W) of AcrIIA28 by SEC followed by SDS-PAGE analysis.

    Journal: Nucleic acids research

    Article Title: AcrIIA28 is a metalloprotein that specifically inhibits targeted-DNA loading to SpyCas9 by binding to the REC3 domain.

    doi: 10.1093/nar/gkae357

    Figure Lengend Snippet: Figure 5. Biding mode analysis indicated that the AcrIIA28 residues K7, W45 and S81 are critical for AcrIIA28 binding to Cas9. ( A ) The docking model of A crIIA28 dock ed onto Sp yCas9. Cas9 and dock ed A crIIA28 (orange color) are presented b y surf ace and cartoon models, respectiv ely. ( B ) Analy sis of PPI detail from the docking model of A crIIA28 / Sp yCas9 comple x. Four PPI regions are independently magnified. T he residues in v olv ed in the interaction are labeled. ( C ) Interaction analysis between SpyCas9 and various tentative PPI-disrupting mutants of AcrIIA28 by SEC followed by SDS-PAGE analysis. SDS-PAGE gels produced by loading one of the main fractions from the SpyCas9 sample with wild-type or various mutants are shown. A black arrow indicates acrIIA28 mutants that co-migrated with SpyCas9. ( D ) The bar chart shows the quantified intensity of the co-eluted AcrII28 mutants. Data are presented as the mean ± standard deviation from three independent experiments. ( E ) Interaction analysis between SpyREC3 and three PPI-disrupting mutants (K7D, W45I and S81W) of AcrIIA28 by SEC followed by SDS-PAGE analysis.

    Article Snippet: The S. pyogenes Cas9 (#62731), N. meningitides Cas9 #71474), H. parainfluenzae Cas9 (#121540) and S. mueleri Cas9 (#121541) expression constructs were purchased rom Addgene.

    Techniques: Binding Assay, Labeling, SDS Page, Produced, Standard Deviation

    Figure 7. Proposed model of Cas9 inhibition by AcrIIA28. ( A and B ) EMSA analysis of the effect of AcrIIA28 on the binding of target DNA into Cas9. The number next to each protein indicates the order in which the proteins were added to form the complex. The red star indicates the band newly produced by the RNP / DNA complex. The experiments were performed three times with similar results. ( C and D ) An in vitro anti-CRISPR activity assay was used to compare the inhibitory effect of AcrIIA28 when added before (C) or after (D) the target DNA. Polyacrylamide gels (4%) were stained with SYBR GOLD. The amount of AcrIIA28 added to the reaction is indicated. The numbers next to the agents used in the experiment indicate the order in which agents were added to the reaction: one represents the sample added first, and three represents the sample added last. In the enzyme reaction, + and – indicate added and not added, respectively. ( E ) Proposed model of Cas9 inhibition by AcrIIA28.

    Journal: Nucleic acids research

    Article Title: AcrIIA28 is a metalloprotein that specifically inhibits targeted-DNA loading to SpyCas9 by binding to the REC3 domain.

    doi: 10.1093/nar/gkae357

    Figure Lengend Snippet: Figure 7. Proposed model of Cas9 inhibition by AcrIIA28. ( A and B ) EMSA analysis of the effect of AcrIIA28 on the binding of target DNA into Cas9. The number next to each protein indicates the order in which the proteins were added to form the complex. The red star indicates the band newly produced by the RNP / DNA complex. The experiments were performed three times with similar results. ( C and D ) An in vitro anti-CRISPR activity assay was used to compare the inhibitory effect of AcrIIA28 when added before (C) or after (D) the target DNA. Polyacrylamide gels (4%) were stained with SYBR GOLD. The amount of AcrIIA28 added to the reaction is indicated. The numbers next to the agents used in the experiment indicate the order in which agents were added to the reaction: one represents the sample added first, and three represents the sample added last. In the enzyme reaction, + and – indicate added and not added, respectively. ( E ) Proposed model of Cas9 inhibition by AcrIIA28.

    Article Snippet: The S. pyogenes Cas9 (#62731), N. meningitides Cas9 #71474), H. parainfluenzae Cas9 (#121540) and S. mueleri Cas9 (#121541) expression constructs were purchased rom Addgene.

    Techniques: Inhibition, Binding Assay, Produced, In Vitro, CRISPR, Activity Assay, Staining